Gene Synthesis - Per bp - 5'UTR sequence from Custom gene: 5'-CTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATT TCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGA AATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATAT GTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAA CAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACT CTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCAC A -3' 285bp + 60 bp cloning sites = 345bp Not a deliverable. Use for C452.

https://www.cortex-biochem.com/web/image/product.template/40081/image_1920?unique=44abc95

300.00 € 300.0 EUR 300.00 €

300.00 €

Not Available For Sale

This combination does not exist.

Terms and Conditions
30-day money-back guarantee
Shipping: 2-3 Business Days